View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_57 (Length: 241)
Name: NF10111_low_57
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10111_low_57 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 38942154 - 38942369
Alignment:
| Q |
18 |
acttacacatacataacttcaaaaggcatctaagcctttgnnnnnnnattcattattattaaccacttgtgtgggatgggatacatgtctc-gcatgcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
38942154 |
acttacacatacataacttcaaaaggcatctaagcctttgtttttttattcattattattaaccacttgtgtgggat-----acatgtctcagcatgcaa |
38942248 |
T |
 |
| Q |
117 |
aaagccttagaaacagtgtttgtttgtttctaagctgcagctctgcgttcggactcacggggtggaactagaaatttaaagagattgttgattttgagct |
216 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38942249 |
aaagccttagaaacggtgtt----tgtttctaagctgcagctctgcgttcggactcacggggtggaactagaaatttaaagagattgttgtttttgagct |
38942344 |
T |
 |
| Q |
217 |
gccttgcctcattcctgtccatgtt |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38942345 |
gccttgcctcattcctgtccatgtt |
38942369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 147 - 241
Target Start/End: Original strand, 38949711 - 38949805
Alignment:
| Q |
147 |
taagctgcagctctgcgttcggactcacggggtggaactagaaatttaaagagattgttgattttgagctgccttgcctcattcctgtccatgtt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
38949711 |
taagctgcagctctgcgttcggactcacggggtggaactagaaatttatagagattgttgttcttgagctgccttgcctcattcctgtccatgtt |
38949805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University