View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10111_low_58 (Length: 241)

Name: NF10111_low_58

Description: NF10111

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF10111_low_58

[»] chr7 (1 HSPs)

[»] chr2 (1 HSPs)

Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 126; E-Value: 4e-65

Query Start/End: Original strand, 86 - 223

Target Start/End: Original strand, 20356353 - 20356490

Alignment:

Q	86	tttagtcttgaatggttaaacgttacatgtaatcttttccttgattacaattgactaatctttgcaattatcttcatatttgatgcacttcatttccttt	185	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|
T	20356353	tttagtcttgaatggttaaacgttacatgtaatctttttcttgattacaattgactaatctttgcaattaccttcatatttgatgcacttcattttcttt	20356452	T

Q	186	gcaattacgctttggcatacatgattggttgatcctag	223	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	20356453	gcaattacgctttggcatacatgattggttgatcctag	20356490	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)

Name: chr2

Description:

Target: chr2; HSP #1

Raw Score: 30; E-Value: 0.00000008

Query Start/End: Original strand, 128 - 177

Target Start/End: Original strand, 17157095 - 17157144

Alignment:

Q	128	gattacaattgactaatctttgcaattatcttcatatttgatgcacttca	177	Q
		\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\| \|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	17157095	gattacagttgacgaatcattgcatttaacttcatatttgatgcacttca	17157144	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]