View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_58 (Length: 241)
Name: NF10111_low_58
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10111_low_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 86 - 223
Target Start/End: Original strand, 20356353 - 20356490
Alignment:
| Q |
86 |
tttagtcttgaatggttaaacgttacatgtaatcttttccttgattacaattgactaatctttgcaattatcttcatatttgatgcacttcatttccttt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20356353 |
tttagtcttgaatggttaaacgttacatgtaatctttttcttgattacaattgactaatctttgcaattaccttcatatttgatgcacttcattttcttt |
20356452 |
T |
 |
| Q |
186 |
gcaattacgctttggcatacatgattggttgatcctag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20356453 |
gcaattacgctttggcatacatgattggttgatcctag |
20356490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 177
Target Start/End: Original strand, 17157095 - 17157144
Alignment:
| Q |
128 |
gattacaattgactaatctttgcaattatcttcatatttgatgcacttca |
177 |
Q |
| |
|
||||||| ||||| |||| ||||| ||| ||||||||||||||||||||| |
|
|
| T |
17157095 |
gattacagttgacgaatcattgcatttaacttcatatttgatgcacttca |
17157144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University