View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_65 (Length: 238)
Name: NF10111_low_65
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10111_low_65 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 5335127 - 5334913
Alignment:
| Q |
18 |
aagattgttgcattgttgatataataacactcgacgagtttaactcagtgactcggttgagttagttagttaagttnnnnnnn-ctcggtatccggtcca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5335127 |
aagattgttgcattgttgatataataacactcgacgagtttaactcagtgactcggttgagttagttagttaagttaaaaaaaactcggtatccggtcca |
5335028 |
T |
|
| Q |
117 |
ataacaagtcact-----------gtatccggtatccggtccaaggagcgactaaggcgggatcgagttagttatgatatgtttaaggttggatctgata |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5335027 |
ataacaagtcactaatcagactctgtatccggtatccggtccaaggagcgactaaggcgggatcgagttagttatgttatgtttaaggttggatctgata |
5334928 |
T |
|
| Q |
206 |
gtagatggtggagtg |
220 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5334927 |
gtagatggtggagtg |
5334913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University