View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_69 (Length: 212)
Name: NF10111_low_69
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10111_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 39291330 - 39291140
Alignment:
| Q |
18 |
tatgttatgattacgtttatcctctgtaactactccgaatggtaccaatgcgcgtatcaaagcaattgcaccccttccaaggtttactccctctgcgcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39291330 |
tatgttatgattacgtttatcctctgtaactacttcgaatggtaccaatgcgcgtatcaaagcgattgcaccccttccaaggtttactccctctgcgcaa |
39291231 |
T |
 |
| Q |
118 |
tgtgtccataatgacagttcgttttttagttatctatgtttataattatgactatctcgcatatatttgaagtttcttcctttgcttctcc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39291230 |
tgtgtccataatgacagttcgttttttagttatctatgtttataattatgactatctcgcatatatttgaagtttcttccttctcttctcc |
39291140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University