View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10112_low_19 (Length: 255)
Name: NF10112_low_19
Description: NF10112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10112_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 41301049 - 41301277
Alignment:
| Q |
17 |
gtggtcccttattcacctcataaagacaagttcttgtgccaataagaattgtttgctttatgatatgtcatttttataattggttcgccggtgcctttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41301049 |
gtggtcccttattcacctcataaagacaagttcttgtgccaataagaattgtttgctttatgatatgtcatttttataattggttcgccggtgcctttct |
41301148 |
T |
 |
| Q |
117 |
aaaaaattaaattggc-tttcaattagtgttggaggcactactagggttaattttaaggatgagattgcatgctctttaatgaatgcaatgcaacttgtg |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41301149 |
aaaaaattaaattggcttttcaattagtattggaggcactactagggttaattttaaggatgagattgcatgctctttaatgaatgcaatgcaacttgtg |
41301248 |
T |
 |
| Q |
216 |
tttataaaggtttatcaacagcccttcat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41301249 |
tttataaaggtttatcaacagcccttcat |
41301277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University