View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10112_low_20 (Length: 250)
Name: NF10112_low_20
Description: NF10112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10112_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 3 - 107
Target Start/End: Original strand, 43076073 - 43076177
Alignment:
| Q |
3 |
gtgaaatatagtttcgtaaagagcttggaaagtgagtgttatgttatcccaacaagaatatttttcacattcacacacaagaataaagggactcacggga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43076073 |
gtgaaatatagtttcgtaaagagcttggaaagtgagtgttatgttatcccaacaagaatacttttcacattcacacacaagaataaagggactcacggga |
43076172 |
T |
|
| Q |
103 |
agcac |
107 |
Q |
| |
|
||||| |
|
|
| T |
43076173 |
agcac |
43076177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 196 - 242
Target Start/End: Original strand, 43076266 - 43076312
Alignment:
| Q |
196 |
tgcaacatgtcccgtgcctgtggtttagaatttagattgttcatctc |
242 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43076266 |
tgcaacatgtcctgtgcctgtggtttagaatttagattgttcatctc |
43076312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University