View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10112_low_22 (Length: 241)
Name: NF10112_low_22
Description: NF10112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10112_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 226
Target Start/End: Original strand, 3655470 - 3655687
Alignment:
| Q |
10 |
gtttgagacgccttttctaactcctcaataagttgtatcaaaattttgttaaatttggtggaggagcgggatggatcctagtgtttggatcgaatattgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
3655470 |
gtttgagacgccttttctaactcctcaacaagttgtatcaaaattttgttgaatttggtggaggagcgggatggaccctagtgtttagatcgaatattgg |
3655569 |
T |
 |
| Q |
110 |
atgtcggatactcacacttgaggatgagattgttgaattgaaatatgtgaat-accagtcttatatgaatgagttaaatgctagatatataaaataggtg |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3655570 |
atgtcggatactcacacttaaggatgagattgttgaattgaaatatgtgaatggttagtcttatatgaatgagttaaatgctagatatataaaataggtg |
3655669 |
T |
 |
| Q |
209 |
acatgcatacatgatgtc |
226 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3655670 |
acatgcatacatgatgtc |
3655687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University