View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_high_10 (Length: 249)
Name: NF10113_high_10
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10113_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 69 - 173
Target Start/End: Complemental strand, 44546115 - 44546011
Alignment:
| Q |
69 |
gtataggtgatacctgtaacctgtgttgcattgcgtcatgcgtgtgatgttggagaaacgcagatgtgacaagagataagctgagcaaagtatttctact |
168 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44546115 |
gtataggtgaaacctgtaacctgtgttgcattgcgtcatgcgtgtgatgttggagaaacgcagatgtgacaagagataagcttagcaaagtatttctact |
44546016 |
T |
|
| Q |
169 |
tttag |
173 |
Q |
| |
|
||||| |
|
|
| T |
44546015 |
tttag |
44546011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 44545197 - 44545136
Alignment:
| Q |
170 |
ttagatcctaaataaaccaaactacagacgatacttgtctggtcgtgccctcaaaccaaata |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44545197 |
ttagatcctaaataaaccaaactacagacgatacttgtcaggtcgtgccctcaaaccaaata |
44545136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University