View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_high_11 (Length: 248)
Name: NF10113_high_11
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10113_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 124 - 235
Target Start/End: Original strand, 44130128 - 44130239
Alignment:
| Q |
124 |
ttgagtggaagtatttgtgatggtgaaggggatgatgatcatcattagcaaaggtttggtggaagataatgatgatgtttgtgataaaagaagaggtggg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44130128 |
ttgagtggaagtatttgtgatggtgaaggggatgatgatcatcattagcaaaagtttggtggaagataatgatgatgtttgtgataaaagaagaggtggg |
44130227 |
T |
 |
| Q |
224 |
agtgtaatgatg |
235 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44130228 |
agtgtaatgatg |
44130239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 44130014 - 44130076
Alignment:
| Q |
19 |
cctactctcttcactctttatataatcaagttgttgaaactggaatattgaagtagctagggt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44130014 |
cctactctcttcactctttatataatcaagttgttgaaactggaatattgaagtagctagggt |
44130076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University