View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_high_12 (Length: 248)
Name: NF10113_high_12
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10113_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 11591915 - 11591743
Alignment:
| Q |
1 |
cacccattatggccatgttaagttgcgaatggaatcgctggttcgatgggaggcaggcgcccccaaaaggccgggcagcttcaacaaaatcattttatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11591915 |
cacccattatggccatgttaagttgcgaatggaatcgctggttcgaggggaggcgggcacccccaaaaagccgggcagcttcaacaaaatcattttatcg |
11591816 |
T |
|
| Q |
101 |
aagtcaccataaacatatgacattattttgattctactatctataggcatttgtcccttttgtttgattattg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11591815 |
aagtcaccataaacatatgacattattttgattctactatctataggcatttgtcctttttgtttgattattg |
11591743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 106 - 237
Target Start/End: Original strand, 11646246 - 11646375
Alignment:
| Q |
106 |
accataaacatatgacattattttgattctactatctataggcatttgtcccttttgtttgattattggcaaaatgaggaatgaaagttttatttatagc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11646246 |
accataaacatatgacattattttgattctactatctataggcatttgtcccttttgtttgattattggcaaaatgaggaatgaaagttttatttatagc |
11646345 |
T |
|
| Q |
206 |
tctttgcaatctcagagttctctcaagtctct |
237 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
11646346 |
tctttgcaatctc--agttctctcaagtctct |
11646375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 11646203 - 11646245
Alignment:
| Q |
1 |
cacccattatggccatgttaagttgcgaatggaatcgctggtt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11646203 |
cacccattatggccatgttaagttgcgaatggaatcgctggtt |
11646245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University