View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10113_low_22 (Length: 312)

Name: NF10113_low_22
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10113_low_22
NF10113_low_22
[»] chr7 (1 HSPs)
chr7 (6-274)||(18498604-18498872)


Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 6 - 274
Target Start/End: Original strand, 18498604 - 18498872
Alignment:
6 aggagcacagaggcttcaatctaaaatctagagatttagattgggtagatttccactcaactcgctaacattaggagcttaagaagagaagtgtgcaaga 105  Q
    |||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
18498604 aggaacaccgaggcttcattctaaaatctagagatttagattgggtagatttccactcaactcgctaacattgggagcttaagaagagaagtgtgcaaga 18498703  T
106 tggttgtagatggaaagcttggtcaggaagtaaccgatggaaaaggtcagtggtaagccaaagcagcaggttagtgaacctacccgtttaattgtgaaag 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18498704 tggttgtagatggaaagcttggtcaggaagtaaccgatggaaaaggtcagtggtaagccaaagcagcaggttagtgaacctacccgtttaattgtgaaag 18498803  T
206 ctgagaaaccgaaaaagaaagatagcaaggttaataagatgcaagtacttttggagattctataaaata 274  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||    
18498804 ctgagaaaccgaaaaagaaagatagcaagattaataagatgcaagtacttttggagattctagaaaata 18498872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University