View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_low_24 (Length: 304)
Name: NF10113_low_24
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10113_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 15 - 290
Target Start/End: Original strand, 6466330 - 6466605
Alignment:
Q |
15 |
tggacatcagttagcgacccttattttatattaaaaacatttcataatctttcaatactttttctccaaacctcaaaatatttcagagttatgtttgtaa |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6466330 |
tggacatcagttagcgacccttattttatattaaaaacatttcataatctttcaatactttttctccaaacctcaaaatatttcagagttatgtttgtaa |
6466429 |
T |
 |
Q |
115 |
caattattcttactatttttattttcaggaaacaatgaagatggacgtatgatgttaaatcaaaccttcacgattggtaannnnnnnncaatacaatata |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
6466430 |
caattattcttactatttttattttcaggaaacaatgaagatggacgtatgatgttaaatcaaaccttcacgattggtaattttttttcaatacaatata |
6466529 |
T |
 |
Q |
215 |
gattgttatgaactaatgcttatgattattgtttgcgaagctggaatctttgcatttgttttgctcttgttctctg |
290 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6466530 |
gattgttatgaactaatgcttatgattattgtttgcgaagctggaatctttgcatttgttttgctcttgttctctg |
6466605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University