View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10113_low_25 (Length: 299)

Name: NF10113_low_25
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10113_low_25
NF10113_low_25
[»] chr5 (2 HSPs)
chr5 (57-143)||(13281898-13281985)
chr5 (202-268)||(13281823-13281889)


Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 57 - 143
Target Start/End: Complemental strand, 13281985 - 13281898
Alignment:
57 aaatgagtgagatattccataactaaatgtctcattaattatt-attgttttgactaaaaatgtctcattatttctaacaaaacaaac 143  Q
    ||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||    
13281985 aaatgagtgagatatcccataactaaatgtctcattaattattaatttttttgactaaaaatgtttcattatttctaacaaaacaaac 13281898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 268
Target Start/End: Complemental strand, 13281889 - 13281823
Alignment:
202 gtttttaggggtaagaaatagatagataatttactttattttttacagaaactaacggctaaagaga 268  Q
    |||||||||||||||| |||||||||||  | | |   |||||||||||||||||||||||||||||    
13281889 gtttttaggggtaagagatagatagataggtaattcacttttttacagaaactaacggctaaagaga 13281823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University