View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_low_25 (Length: 299)
Name: NF10113_low_25
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10113_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 57 - 143
Target Start/End: Complemental strand, 13281985 - 13281898
Alignment:
| Q |
57 |
aaatgagtgagatattccataactaaatgtctcattaattatt-attgttttgactaaaaatgtctcattatttctaacaaaacaaac |
143 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13281985 |
aaatgagtgagatatcccataactaaatgtctcattaattattaatttttttgactaaaaatgtttcattatttctaacaaaacaaac |
13281898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 268
Target Start/End: Complemental strand, 13281889 - 13281823
Alignment:
| Q |
202 |
gtttttaggggtaagaaatagatagataatttactttattttttacagaaactaacggctaaagaga |
268 |
Q |
| |
|
|||||||||||||||| ||||||||||| | | | ||||||||||||||||||||||||||||| |
|
|
| T |
13281889 |
gtttttaggggtaagagatagatagataggtaattcacttttttacagaaactaacggctaaagaga |
13281823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University