View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_low_35 (Length: 252)
Name: NF10113_low_35
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10113_low_35 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 7 - 252
Target Start/End: Complemental strand, 52612379 - 52612134
Alignment:
| Q |
7 |
gagaagcatagggtagatgtttgaaaaacactattgcattatgactcttttgctatttttgtcatttgctagacaacaacttcacttttatcaccatatc |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
52612379 |
gagaagcaaagggtagatgtttgaaaaacactattgcattatgactcttttgctatttttgtcatttgctagacaacaacttaacttttctcaccatatc |
52612280 |
T |
 |
| Q |
107 |
aaaagaagctatgcttgaaacttttcataaatgtacccacaagtttaaaattgtttccacaaatagaatggttaatgcctgaaaaattgctggcaaaaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52612279 |
aaaagaagctatgcttgaaacttttcataaatgtacccacaagtttaaaattgtttccacaaatagaatggttaatgcctgaaaaattgctggcaaaaca |
52612180 |
T |
 |
| Q |
207 |
cggttttaaaggaacacagctaactagttgaacatgcttttcagtt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52612179 |
cggttttaaaggaacacagctaactagttgaacatgcttttcagtt |
52612134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University