View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_low_36 (Length: 250)
Name: NF10113_low_36
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10113_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 1323760 - 1323527
Alignment:
Q |
1 |
aagattataagataagataagatattgcgtatatgagactttagaaataattattgttaaagttaggttattttaatgatttgacaattatgaacgactg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| ||| |||||||||||| || |
|
|
T |
1323760 |
aagattataagataagataagatattgcgtatatgagattttagaaataattatcgttgaagttaggttattttaatgatctgataattatgaacgattg |
1323661 |
T |
 |
Q |
101 |
acggtgtaaaaaatatttacgttaacgatgaatgaattaatattgtttatataattctaataggagaaggtgtttgagatttacctcaacaatttttgga |
200 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
1323660 |
acggtgtaaaaaata-----------gatgaatgaattaatattgtgtatataattctaataggagaagttgtttgagatttacctcaacaatttttgga |
1323572 |
T |
 |
Q |
201 |
gttcttcaatagcttcatcatagccctttcccatttcttctctct |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1323571 |
gttcttcaatagcttcatcatagccctttcccatttcttctctct |
1323527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University