View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_low_43 (Length: 242)
Name: NF10113_low_43
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10113_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 13616933 - 13616728
Alignment:
Q |
16 |
atgaagtatgtaggaaggaagtatcaactaacttactagaagaaaaattataagcatttttagatgagtaatcaccatctttttcgcccttcaaatttgc |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
13616933 |
atgaagtatgtaggaaggaagtatcaactaacttactagaagaaaaattataagcatttttagatgagtaatcaccatccttttcgcccttcaaatttgc |
13616834 |
T |
 |
Q |
116 |
ttaccctctattacaccataggagataacaatgtattgacaatattagccacattatcattatcatcaactacaaatgtaatcaatagaatgttctaagg |
215 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13616833 |
ttaccctctatt--accataggagataacaatgtattgacaatattagccacattatcattatcatcaactacaaatgtaatcaatagaatgttctaagg |
13616736 |
T |
 |
Q |
216 |
cttatcat |
223 |
Q |
|
|
|||||||| |
|
|
T |
13616735 |
cttatcat |
13616728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University