View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_low_49 (Length: 227)
Name: NF10113_low_49
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10113_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 5595868 - 5595977
Alignment:
| Q |
1 |
tgcagactttgagttggaatagtgcctatgacgtttatggtgattttggcgacgttgtctcggtgcagaagggagtgaagagtagtttggtggaggggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5595868 |
tgcagactttgagttggaatagtgtctatgacgtttatggtgattttggcgacgttgtctcggtgcagaagggagtgaagagtagtttggtggaggggtt |
5595967 |
T |
 |
| Q |
101 |
ggtttagaag |
110 |
Q |
| |
|
||| |||||| |
|
|
| T |
5595968 |
ggtgtagaag |
5595977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 148 - 207
Target Start/End: Original strand, 5596018 - 5596078
Alignment:
| Q |
148 |
gggtatctaaaatcaataacaagttttcaacttgatgat-taggtttgatactctgacaca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
5596018 |
gggtatctaaaatcaataacaagttttcaacttgatgatctaggttcgatactctgacaca |
5596078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 65 - 116
Target Start/End: Complemental strand, 5604872 - 5604821
Alignment:
| Q |
65 |
gcagaagggagtgaagagtagtttggtggaggggttggtttagaagccattg |
116 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
5604872 |
gcagcagggagtgaggagtagtttggtggaggggttggtgtagaagtcattg |
5604821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University