View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10113_low_8 (Length: 457)
Name: NF10113_low_8
Description: NF10113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10113_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 17 - 440
Target Start/End: Complemental strand, 43102227 - 43101796
Alignment:
Q |
17 |
agaccaaggggtggcttctaccatcatttgattcctctgccccagatgtctagctaaactacccagggcatgttgtcctcccattgaagatgggataatc |
116 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
43102227 |
agaccaaggggtggcttctaccatcatttgattcctctgccccagatgtctagctaaactacccagggcatgtagtcctcccattgaagatgggataatc |
43102128 |
T |
 |
Q |
117 |
tgggattgtttgacatggtcctttccatttgctcttttacttgacatttttcttctagaatcatttcactgaggttcctgttacttcggtcattgtaaaa |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
43102127 |
tgggattgtttgacatggtcctttccatttgctcttttacttgacatttttcttctagaatcatttcactgaggtttctgttacttcggtcattgtaaaa |
43102028 |
T |
 |
Q |
217 |
agttggtcttatttcatttacagcttttcaggataatgttgcatcaagaggtagttgtcttttaacatttactctctctggatgaagggtctgttggttg |
316 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
43102027 |
agttggtcttatttcatttacagcttttcaggataatgttgcatcaagaggtagttgtcttttaacatttact--ctctggatgaagggtctgttggttg |
43101930 |
T |
 |
Q |
317 |
tgcacttttacaccattagatcaagtttagtttgaaagatatatcaattggctactatttttagattcctggtttcggtctccaattttcaaaat----- |
411 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43101929 |
tgcacttttacaccattagatcaagtttagtttgaaagatatatcaaatggctactatttttagattcctggtttcggtctccaattttcaaaatattta |
43101830 |
T |
 |
Q |
412 |
-----tttcccacctatgcatgcttaatgtgatg |
440 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
43101829 |
aaaaatttcccacctatgcatgcttaatgtgatg |
43101796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University