View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10114_low_20 (Length: 266)
Name: NF10114_low_20
Description: NF10114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10114_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 6571462 - 6571679
Alignment:
| Q |
1 |
tcatcatgtgatggtagtaggtgttggatttatgttcctttgacgagacagatttggctggtttgatacagaaaaagtgtttctctcttacaagttacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
6571462 |
tcatcatgtgatggtagtaggtgttggatttatgttcctttgacgagacagagttggctggtttgatacaaaaaacgtgtttctctc-------ttacaa |
6571554 |
T |
 |
| Q |
101 |
cccttatcttcttttattcactcactctc--tattcnnnnnnnnnnnnnctgcggtgattccagattctattagtagaaacaagctcaggtaattctctc |
198 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6571555 |
cccttatcttcttttaatcactcactctctatattctttttttctttttctgcggtgattccagattctattagtagaaacaagctcaggtaattctctc |
6571654 |
T |
 |
| Q |
199 |
aaattatctctttaatagtacacta |
223 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
6571655 |
aaatcatctctttaatagtacacta |
6571679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University