View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10114_low_23 (Length: 242)
Name: NF10114_low_23
Description: NF10114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10114_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 57 - 226
Target Start/End: Original strand, 47145376 - 47145545
Alignment:
| Q |
57 |
tatagccatagtattacactagatttggaattatttccaatcatttcaattcaattattcactttccacttctgcctaaatggctgtttctcctgtttgt |
156 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47145376 |
tatagccataggattagactagatttggaattatttccaatcaattcaattcaattattcactttccacttctgcctaaatggctgtttctcctgtttgt |
47145475 |
T |
 |
| Q |
157 |
gccaattgaattcaattcaattacccaacattttagaggctgattttcttccctcatctttcaattcttt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47145476 |
gccaattgaattcaattcaattacccaacattttagaggctgattttctgccctcatctttcaattcttt |
47145545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University