View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10114_low_25 (Length: 218)
Name: NF10114_low_25
Description: NF10114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10114_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 47145353 - 47145163
Alignment:
| Q |
1 |
atacatagggaggggagtgagtgactcaccccatgcaagcgaagaggtcagtgatccaagcagtaatcatcatcaccatatattgttgttactatttgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47145353 |
atacatagggaggggagtgagtgactcaccccatgcaagcgaagaggtcagtgatccaagcagtaatcatcatcaccatctattgttgttactatttgtt |
47145254 |
T |
 |
| Q |
101 |
atcaacacaaccacatacatacatacagaggagaggacaagaagcagaaggaagaagtttcttcggagcgagcgagcgaatgaaagacacacacg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47145253 |
atcaacacaaccacatacatacatacagaggagaggacaagaagcagaaggaagaagtttcttcggagcga----gcgaatgaaagacacacacg |
47145163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University