View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10115_high_13 (Length: 203)
Name: NF10115_high_13
Description: NF10115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10115_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 47884665 - 47884839
Alignment:
| Q |
19 |
aaagcttgtgtgtactgttggtcctgcttgtagttcattggaggatctagagaagttggcattgggaggaatgaatgttgctaggcttaatatgtgtcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47884665 |
aaagcttgtgtgtactgttggtcctgcttgtagttcattggaggatctagagaagttggcattgggaggaatgaatgttgctaggcttaatatgtgtcat |
47884764 |
T |
|
| Q |
119 |
ggtactagagaatggcaccgtgatgttattaggaagattaagaagcttaatgaggaaaagggtttctctgcttct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47884765 |
ggtactagagaatggcaccgtgatgttattaggaagattaagaagcttaatgaggaaaagggtttctctgtttct |
47884839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University