View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10115_low_1 (Length: 477)
Name: NF10115_low_1
Description: NF10115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10115_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 426; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 426; E-Value: 0
Query Start/End: Original strand, 16 - 469
Target Start/End: Complemental strand, 29904955 - 29904502
Alignment:
| Q |
16 |
caacgagaaggttatactttgttactatggtgataatctttttgggatatatcatagcaagaaacatgaaaaccctgaccagattccaacttatcatagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29904955 |
caacgagaaggttatactttgttactatggtgataatctttttgggatatatcatagcaagaaacatgaaaaccctgaccagattccaacttatcatagc |
29904856 |
T |
 |
| Q |
116 |
ctaggcttgcgggttggatgcacaatgcacttttatcttcagccgaatgcattaagtgccatcagttctcacttggttggtatattagttctacatggat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29904855 |
ataggcttgcgggttggatgcacaatgcacttttatcttcagctgaatgcattaagtgccatcagttctcacttggttggtatattagttctacatggat |
29904756 |
T |
 |
| Q |
216 |
gcaccttcgaggaaaactgcgctgggaatgagatggaaggaattttgtgatgaaaatgggttcaatgttcgtgacattctctgtttcaagtttgagattg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29904755 |
gcaccttcgaggaaaactgcgctgggaatgagatggaaggaattttgtgatgaaaatgggatcaatgttcgtgacattctctgtttcaagtttgagattg |
29904656 |
T |
 |
| Q |
316 |
ttaacccaaaaaagagtggtcatgtttttaaagttcagatgtgagcatctgtttctcatgtctctcccacgaagagttagtgtattattttgagtgttgt |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29904655 |
ttaacccaaaaaagagtggtcatgtttttaaagttcggatgcgagcatctgtttctcatgtctctcccacgaagagttagtgtattgttttgagtgttgt |
29904556 |
T |
 |
| Q |
416 |
ttttatatttatatgttttggctaggctttagttggtaggacttggtctctgct |
469 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29904555 |
ttttatatttatatgttttggctaggctttagttggtaggacttggtctttgct |
29904502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University