View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10116_low_6 (Length: 255)
Name: NF10116_low_6
Description: NF10116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10116_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 48839198 - 48838975
Alignment:
Q |
18 |
agataaccaaccaattcatcttgttttgtgtatactatagtattagtgccgtgcaatgttgttcatcttcgggtctcaaaactaaactgaccatgcttat |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
T |
48839198 |
agataaccaaccaattcatcttgttttgtgtatactatagtattagtaccgtgcaatgttgttcatcttcgggtctcaaaactcaactgaccatgtttat |
48839099 |
T |
 |
Q |
118 |
atatcgattgaattaatcacgttaaaaatagcgctagttgataagtcagtatatattatattaatc--tataaacttattggagagcgtcgaaagtgata |
215 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| || ||| |||||| |||||||||||||||| | |
|
|
T |
48839098 |
ctatcgattgaattaatcatgttaaaaatagcgctagttgataagt-agtatatattatattaatcgataaaaatttattgaagagcgtcgaaagtgaca |
48839000 |
T |
 |
Q |
216 |
atgggctaaatatccatgactcacc |
240 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
48838999 |
atgggctaaatatccatgactcacc |
48838975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University