View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10117_low_10 (Length: 313)
Name: NF10117_low_10
Description: NF10117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10117_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 292
Target Start/End: Original strand, 34223606 - 34223897
Alignment:
| Q |
1 |
gacgaactacctgttgagcgcagttgaaggcaccgagggatgaaacagctagggaagtttggaaagtttggattgggagatgttgaaaaggagttggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34223606 |
gacgaactacctgttgagcgcagttgaaggcaccgagggatgaaacagctagggaagtttggaaagtttggattgggagatgttgaaaaggagttggttt |
34223705 |
T |
|
| Q |
101 |
ggattgaagaggtgactcataattagcattataaacaagaacttcaacaaatccaagtgaaagtacaccttcaaatgcttctcttacacttcttgaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34223706 |
ggattgaagaggtgactcataattagcattataaacaagaacttcaacaaatccaagtgaaagtacaccttcaaatgcttctcttacacttcttgaatct |
34223805 |
T |
|
| Q |
201 |
gaacaatcaattcttattgcaaacacctgtgccttttcttcccttgctatttcatccgcaaatcttgataacctccctgcatcacatcacat |
292 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34223806 |
gaacaatcaattcttatagcaaacacttgtgccttttcttcccttgctatttcatccgcaaatcttgataacctccctgcatcacatcacat |
34223897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University