View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10117_low_16 (Length: 248)
Name: NF10117_low_16
Description: NF10117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10117_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 142
Target Start/End: Original strand, 10138015 - 10138139
Alignment:
| Q |
18 |
atataaatattagggtgatgcaaaaaccacttattactctgattccgacttgtccgaatcaccatcatctaggagattaacttctgaatgttgtgatctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10138015 |
atataaatattagggtgatgcaaaaaccacttattattctgattccgacttgtccggatcaccatcatctaggagattaacttctgaatgttgtgatctt |
10138114 |
T |
 |
| Q |
118 |
attggaggaaatatgatttcatgga |
142 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10138115 |
attggaggaaatatgatttcatgga |
10138139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 10138136 - 10138195
Alignment:
| Q |
177 |
tggagaccgtactatgacaacatcctcaaaagagcttgcattgctcaggtctctgctcct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||| |
|
|
| T |
10138136 |
tggagaccgtactatgacaacatcctcaaaagaacttgcattgctcaggtatttgctcct |
10138195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University