View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10117_low_17 (Length: 247)
Name: NF10117_low_17
Description: NF10117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10117_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 33 - 229
Target Start/End: Complemental strand, 4673275 - 4673081
Alignment:
Q |
33 |
cacttcttcacacttgatgtatgtgttatcgtgtttcttccactatactattccttatgaaaagagtaaagaagaggaccagggtacaaccaagcaaaag |
132 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
4673275 |
cacttcttcacacttgatgtatgtgttatcgtgttttctccactatactattccttatgaaaagagtaaagaagaggaccaggatacaaccaagcaaaag |
4673176 |
T |
 |
Q |
133 |
tggtgaaatggattgagagaaaaggaagcaaacttgtaaacaaacatttttgaaaaagacacacaatttggaagctgcatgcgtccctgcgccgtca |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
4673175 |
tggtgaaatggattgagagaaaaggaagcaaacttgtaaacaaacatttgtgaaaaaga--cacaatttggaagctgcatgcgtccctgcgccgtca |
4673081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University