View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10117_low_19 (Length: 241)
Name: NF10117_low_19
Description: NF10117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10117_low_19 |
 |  |
|
| [»] scaffold0069 (2 HSPs) |
 |  |  |
|
| [»] scaffold0006 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 12)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 13614504 - 13614401
Alignment:
| Q |
1 |
tgcaaacgaacatattcaactttatgaaagatattttcttgattcaatatccccaagacatctctgccatttattgccatttgctccagattggggccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13614504 |
tgcaaacgaacatattcaactttatgaaagatattttcttgattcaatatccccaagacatctctgccatttattgccatttgctccagattggggccca |
13614405 |
T |
 |
| Q |
101 |
actg |
104 |
Q |
| |
|
|||| |
|
|
| T |
13614404 |
actg |
13614401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 20508462 - 20508565
Alignment:
| Q |
1 |
tgcaaacgaacatattcaactttatgaaagatattttcttgattcaatatccccaagacatctctgccatttattgccatttgctccagattggggccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
20508462 |
tgcaaacgaacatattcaactttatgaaagatattttcttgattcaatatccccaagacatctctgccatttattgccatttcctctagattggggccca |
20508561 |
T |
 |
| Q |
101 |
actg |
104 |
Q |
| |
|
|||| |
|
|
| T |
20508562 |
actg |
20508565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 13614346 - 13614282
Alignment:
| Q |
159 |
cggtgtaaatatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
223 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13614346 |
cggtataaatatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
13614282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 20379948 - 20379884
Alignment:
| Q |
159 |
cggtgtaaatatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
223 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20379948 |
cggtgtagatatggtggggtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
20379884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 13554610 - 13554546
Alignment:
| Q |
159 |
cggtgtaaatatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
223 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13554610 |
cggtgtatatatggtggggtttaccttttcaatacaaaacagtggttgttggaatagcatgtcct |
13554546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 219
Target Start/End: Complemental strand, 13688788 - 13688728
Alignment:
| Q |
159 |
cggtgtaaatatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatg |
219 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13688788 |
cggtgtagatatggtggggtttaccttttcaatacaaaacaggggttgttggaatagcatg |
13688728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 168 - 223
Target Start/End: Original strand, 19134479 - 19134534
Alignment:
| Q |
168 |
tatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
223 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19134479 |
tatggcggaatttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
19134534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 168 - 223
Target Start/End: Original strand, 20508624 - 20508680
Alignment:
| Q |
168 |
tatggtgga-gtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
223 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20508624 |
tatggtggaagtttaccttttcaatacaaaataggggttgttggaatagcatgtcct |
20508680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 178 - 219
Target Start/End: Complemental strand, 13519237 - 13519196
Alignment:
| Q |
178 |
tttaccttttcaatacaaaacaggggttgttggaatagcatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13519237 |
tttaccttttcaatacaaaacaggggttgttggaatagcatg |
13519196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 79
Target Start/End: Original strand, 16446442 - 16446492
Alignment:
| Q |
29 |
agatattttcttgattcaatatccccaagacatctctgccatttattgcca |
79 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
16446442 |
agatattttcttgattcaatatccctaacacatctgtgccatttattgcca |
16446492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 13688955 - 13688913
Alignment:
| Q |
1 |
tgcaaacgaacatattcaactttatgaaagatattttcttgat |
43 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
13688955 |
tgcaaacgaagaaattcaactttatgaaatatattttcttgat |
13688913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 13438695 - 13438642
Alignment:
| Q |
168 |
tatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtc |
221 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| ||||| ||||| |||||| |
|
|
| T |
13438695 |
tatggtgggatttaccttttcaatgcaaaacagggcttgttcgaataccatgtc |
13438642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0069 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: scaffold0069
Description:
Target: scaffold0069; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 59737 - 59673
Alignment:
| Q |
159 |
cggtgtaaatatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
223 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
59737 |
cggtgtagatatggtggggtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
59673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0069; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 44642 - 44578
Alignment:
| Q |
159 |
cggtgtaaatatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
223 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44642 |
cggtgtagatatggtggggtttaccttttcaatacaaaacaggggttgttggaatagcacgtcct |
44578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 61583 - 61519
Alignment:
| Q |
159 |
cggtgtaaatatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
223 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
61583 |
cggtgtagatatggtggggtttaccttttcaatacaaaacaggggttgttggaaaagcatgtcct |
61519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 177088 - 177024
Alignment:
| Q |
159 |
cggtgtaaatatggtggagtttaccttttcaatacaaaacaggggttgttggaatagcatgtcct |
223 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
177088 |
cggtgtatatatggtggggtttaccttttcaatacaaaataggggttgttggtatagcatgtcct |
177024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 61750 - 61638
Alignment:
| Q |
1 |
tgcaaacgaacatattcaactttatgaaagatattttcttg---------attcaatatccccaagacatctctgccatttattgccatttgctccagat |
91 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||||||||||| ||||||||||||||| | ||| ||||||||| ||||| || |||||| | |
|
|
| T |
61750 |
tgcaaacgaagaaattcaactttatgaaatatattttcttgatgacaaccattcaatatccccaacatatccgtgccatttactgccaattcctccaggt |
61651 |
T |
 |
| Q |
92 |
tggggcccaactg |
104 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
61650 |
tggggctcaactg |
61638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 209
Target Start/End: Original strand, 20766965 - 20767015
Alignment:
| Q |
159 |
cggtgtaaatatggtggagtttaccttttcaatacaaaacaggggttgttg |
209 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20766965 |
cggtgtagatatggtggggtttaccttttcaatacaaaacaggggttgttg |
20767015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 212
Target Start/End: Original strand, 22271585 - 22271619
Alignment:
| Q |
178 |
tttaccttttcaatacaaaacaggggttgttggaa |
212 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22271585 |
tttaccttttcaatacaaaacagggcttgttggaa |
22271619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University