View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_high_10 (Length: 250)
Name: NF10118_high_10
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10118_high_10 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 54376517 - 54376754
Alignment:
Q |
13 |
taggcgatccggcggagagatactccggcggtggacatttatcgcaaatccacgagagtttatccgagaattgcgatggattttgtgcaatgaggtcgca |
112 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
54376517 |
taggcgatccggcggaaagatactccggcggtggacatttatcgcaaatccacgagagtttatcggagaattgcgatggattttgtgcaatgaggtcgca |
54376616 |
T |
 |
Q |
113 |
taattcgatcaacgcttccatcacgaattagggtgaaaattcaaacgaaaaatgagagaatgttgagatttcagaagagatcgtggcgttcgattctctc |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54376617 |
taattcgatcaacgcttccatcacgaattagggtgaaaattcaaacgaaaaatgagagaatgttgagatttcagaagagatcgtggcgttcgattctctc |
54376716 |
T |
 |
Q |
213 |
tctaaccacgtaccaacattgttactcttcttctcgtc |
250 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
54376717 |
tctaaccacgtaccaacattgttactcttcttctcgtc |
54376754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University