View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_high_19 (Length: 224)
Name: NF10118_high_19
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10118_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 22 - 209
Target Start/End: Complemental strand, 34208178 - 34207989
Alignment:
| Q |
22 |
ccggtgtctactccggcggagcatggcaaaccgctcacgccaccttctacggcggcagcgacgcctctggaacaatgggttagtactagnnnnnnnn--c |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
34208178 |
ccggtgtctactccggcggagcatggcaaaccgctcacgccaccttctacggcggcagcgacgcctccggaacaatgggttagtactagaaaaaaaaaac |
34208079 |
T |
|
| Q |
120 |
aaccaccaaccataccacaattttatttattttttgttctaaaatagctagcaaattcaaactcgtgttgcaacatatcaaatgtctctg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34208078 |
aaccaccaaccataccacaattttatttattttttgttctaaaatacctagcaaattcaaactcgtgttgcaacatatcaaatgtctctg |
34207989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University