View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10118_high_8 (Length: 253)

Name: NF10118_high_8
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10118_high_8
NF10118_high_8
[»] chr4 (5 HSPs)
chr4 (145-213)||(9601726-9601794)
chr4 (154-213)||(9592972-9593031)
chr4 (92-146)||(9601824-9601878)
chr4 (20-59)||(9580998-9581037)
chr4 (20-59)||(9586693-9586732)


Alignment Details
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 9601794 - 9601726
Alignment:
145 tccccacaaactgttgttagatgagtattacttcttatttacattgtagtttctttaccgagttgcttg 213  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||    
9601794 tccccacaaactgttgttagatgagtattacttcttatttacgttgtagtttctttaccaagttgcttg 9601726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 154 - 213
Target Start/End: Complemental strand, 9593031 - 9592972
Alignment:
154 actgttgttagatgagtattacttcttatttacattgtagtttctttaccgagttgcttg 213  Q
    |||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||    
9593031 actgttgttagatgagtattacttcttatttatattgtggtttctttacggagttgcttg 9592972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 146
Target Start/End: Complemental strand, 9601878 - 9601824
Alignment:
92 tcaaatttccatataagtatctgtttgctgtctcctctcattcgcatatatcatc 146  Q
    |||||| |||||| |||||||||||||||| |||||||||||| || ||||||||    
9601878 tcaaatctccatacaagtatctgtttgctgcctcctctcattcacaaatatcatc 9601824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 9581037 - 9580998
Alignment:
20 ggttatgtctataaccttcttaaaataagcataagtgtct 59  Q
    ||||||||||| |||||||||| |||||||||||||||||    
9581037 ggttatgtctaaaaccttcttataataagcataagtgtct 9580998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 9586732 - 9586693
Alignment:
20 ggttatgtctataaccttcttaaaataagcataagtgtct 59  Q
    ||||||||||| |||||||||| |||||||||||||||||    
9586732 ggttatgtctaaaaccttcttataataagcataagtgtct 9586693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University