View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_high_9 (Length: 251)
Name: NF10118_high_9
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10118_high_9 |
 |  |
|
[»] scaffold0112 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 247
Target Start/End: Original strand, 41340442 - 41340677
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcaccaatatctgttgaatcttaaaacttgttcctctaaaaggaaattt |
110 |
Q |
|
|
||||||||||||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41340442 |
caaaggagagaaatcggctatttcaacccgacaatctagatttaatgcgattcaccaatatctgttgaatcttaaaacttgttcctctaaaaggaaattt |
41340541 |
T |
 |
Q |
111 |
gataagccgggttgattagtgcatgtttagaatcacgataaatttaacnnnnnnnnagagaatgataagtttaaaatttaattttgttcaaataagattt |
210 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41340542 |
gataagccgggttgattggtgcatgtttagaatcacgataaatttaa-ttttttttagagaatgataagtttaaaatttaattttgttcaaataagattt |
41340640 |
T |
 |
Q |
211 |
tgtcaagatcatttatcacaatttatgttaaactcac |
247 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
41340641 |
tgtcaagatcatttatcacaatttatgttaaactcac |
41340677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 13440956 - 13441005
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
T |
13440956 |
gagagaaaccgactattccaacccgacagtctagatttaatacgattcac |
13441005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 43572434 - 43572488
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| |||||||||||| ||||||| ||||||| |||||||||||| |||||||| |
|
|
T |
43572434 |
caaacgagagaaaccggctattccaccccgacaatctagatttaatacgattcac |
43572488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 36227393 - 36227344
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
||||||||| | |||||||||||||||||||||| |||||||||||||| |
|
|
T |
36227393 |
gagagaaacttgctattccaacccgacagtctagacttaatgcgattcac |
36227344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 18768301 - 18768352
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgatt |
62 |
Q |
|
|
|||| |||||||||| || ||||||||||||||||||||||||||||||| |
|
|
T |
18768301 |
caaaagagagaaacctactaatccaacccgacagtctagatttaatgcgatt |
18768352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 6901836 - 6901887
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgattcacca |
67 |
Q |
|
|
|||||||||||| ||||||||||||||| |||||||||||| |||||||||| |
|
|
T |
6901836 |
gagagaaaccggctattccaacccgacaatctagatttaatacgattcacca |
6901887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 43612424 - 43612378
Alignment:
Q |
19 |
agaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
||||||| | ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
43612424 |
agaaacctgctattccaacccgacaatctagatttaatgcgattcac |
43612378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 56
Target Start/End: Complemental strand, 43249051 - 43249006
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaat |
56 |
Q |
|
|
|||| ||||||||||||||||||||||| |||| |||||||||||| |
|
|
T |
43249051 |
caaacgagagaaaccggttattccaacctgacaatctagatttaat |
43249006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 12135124 - 12135168
Alignment:
Q |
21 |
aaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||||||||||||||||| |||| |||||||||||| |||||||| |
|
|
T |
12135124 |
aaaccggttattccaacctgacaatctagatttaatacgattcac |
12135168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 43611430 - 43611384
Alignment:
Q |
19 |
agaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
||||||| | ||||||||||||| ||||||||||||||| ||||||| |
|
|
T |
43611430 |
agaaacctgctattccaacccgatagtctagatttaatgtgattcac |
43611384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 23942985 - 23943034
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||||||| | | ||||||||||||||| |||||||||||| |||||||| |
|
|
T |
23942985 |
gagagaaatctgctattccaacccgacaatctagatttaattcgattcac |
23943034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 15674725 - 15674779
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| ||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
T |
15674725 |
caaaagagagaaaccgtctattccaacccgacagtctagatttaatacgattcac |
15674779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 11469460 - 11469514
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| ||||||||| || ||||||| |||||||||||||||||||| |||||||| |
|
|
T |
11469460 |
caaatgagagaaacaggctattccaccccgacagtctagatttaattcgattcac |
11469514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 26206234 - 26206280
Alignment:
Q |
19 |
agaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
T |
26206234 |
agaaaccgactattccaacccgacagtctagatttaatacgattcac |
26206280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 23872724 - 23872670
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| ||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
T |
23872724 |
caaaagagagaaaccgactattccaacccgacagtctagatttaatacgattcac |
23872670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 55299514 - 55299568
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| ||||||||||| ||||||||||||||| |||||||||||| |||||||| |
|
|
T |
55299514 |
caaaagagagaaaccgactattccaacccgacaatctagatttaatacgattcac |
55299568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 64
Target Start/End: Original strand, 23279696 - 23279749
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattca |
64 |
Q |
|
|
||||||||||||||||||||||||||| || ||||||| |||||| ||||||| |
|
|
T |
23279696 |
caaaggagagaaaccggttattccaactcgtaagtctagttttaattcgattca |
23279749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 26694839 - 26694875
Alignment:
Q |
29 |
tattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||| |
|
|
T |
26694839 |
tattccaacccgtcagtctagatttaatgcgattcac |
26694875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 20675928 - 20675982
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| |||| |||||| |||| ||||||||||||||||||||||| |||||||| |
|
|
T |
20675928 |
caaaagagaaaaaccgactattacaacccgacagtctagatttaatacgattcac |
20675982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 24925932 - 24925878
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| ||||||||||| |||||||||||||||||||||||||| || |||||||| |
|
|
T |
24925932 |
caaaagagagaaaccgtttattccaacccgacagtctagattttatacgattcac |
24925878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 36709820 - 36709856
Alignment:
Q |
29 |
tattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
36709820 |
tattccaacccgacagtctagatttaatgcgattcac |
36709856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 6175724 - 6175670
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| ||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
T |
6175724 |
caaaagagagaaaccgactattccaacccgacagtctagatttaatatgattcac |
6175670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 10868537 - 10868591
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| |||||||||||| ||||||||||||||| |||||||||||| | |||||| |
|
|
T |
10868537 |
caaacgagagaaaccggctattccaacccgacattctagatttaattctattcac |
10868591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 21739727 - 21739690
Alignment:
Q |
19 |
agaaaccggttattccaacccgacagtctagatttaat |
56 |
Q |
|
|
||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
21739727 |
agaaaccggctattccaacctgacagtctagatttaat |
21739690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 65
Target Start/End: Complemental strand, 42674667 - 42674631
Alignment:
Q |
29 |
tattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
||||||||| || |||||||||||||||||||||||| |
|
|
T |
42674667 |
tattccaactcgtcagtctagatttaatgcgattcac |
42674631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 48072673 - 48072619
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| ||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
T |
48072673 |
caaaagagagaaaccgactattccaacccgacagtctagatttaatacgattcac |
48072619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 5497987 - 5498033
Alignment:
Q |
19 |
agaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
T |
5497987 |
agaaaccgactattccaacccgacagtctagatttaatacgattcac |
5498033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 32352559 - 32352505
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| ||||||||||| |||||||||||||||||||||||||||| | |||||| |
|
|
T |
32352559 |
caaaagagagaaaccgactattccaacccgacagtctagatttaatacaattcac |
32352505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 11233731 - 11233682
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||| | |||||| |
|
|
T |
11233731 |
gagagaaaccggttattccaacctgacagtctagatttaattctattcac |
11233682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 9668248 - 9668199
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
||||||||||||||||||||||| |||| |||||||||||| | |||||| |
|
|
T |
9668248 |
gagagaaaccggttattccaacctgacaatctagatttaattctattcac |
9668199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 62
Target Start/End: Complemental strand, 28399797 - 28399746
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgatt |
62 |
Q |
|
|
|||| |||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
T |
28399797 |
caaaagagagaaacctactatgccaacccgacagtctagatttaatgcgatt |
28399746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 13551483 - 13551529
Alignment:
Q |
19 |
agaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||||||| |||||||||| ||||||||||||||||| |||||||| |
|
|
T |
13551483 |
agaaaccgactattccaacctgacagtctagatttaatacgattcac |
13551529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 8065503 - 8065454
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||||||| | | ||||||||||||||| |||||||||||| |||||||| |
|
|
T |
8065503 |
gagagaaatctgctattccaacccgacaatctagatttaatacgattcac |
8065454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 35488736 - 35488785
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||||||| | ||||||||| ||||||| |||||||||||| |||||||| |
|
|
T |
35488736 |
gagagaaatctgttattccatcccgacaatctagatttaatacgattcac |
35488785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 30509270 - 30509216
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| |||||||||||| ||||||| ||||||| |||||||||||| |||||||| |
|
|
T |
30509270 |
caaaagagagaaaccggctattccaccccgacaatctagatttaatacgattcac |
30509216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 30549613 - 30549559
Alignment:
Q |
11 |
caaaggagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||| |||||||||||| ||||||| ||||||| |||||||||||| |||||||| |
|
|
T |
30549613 |
caaaagagagaaaccggctattccaccccgacaatctagatttaatacgattcac |
30549559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 38358366 - 38358412
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgatt |
62 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
38358366 |
gagagaaacctactattccaacccgacagtctagatttaatgcgatt |
38358412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 65
Target Start/End: Complemental strand, 22094478 - 22094442
Alignment:
Q |
29 |
tattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
||||||||||||||||||||| |||||| |||||||| |
|
|
T |
22094478 |
tattccaacccgacagtctagctttaatacgattcac |
22094442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0112 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0112
Description:
Target: scaffold0112; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 14903 - 14854
Alignment:
Q |
16 |
gagagaaaccggttattccaacccgacagtctagatttaatgcgattcac |
65 |
Q |
|
|
|||||||||| | ||||||||||||||| | ||||||||||| ||||||| |
|
|
T |
14903 |
gagagaaacctgctattccaacccgacaatatagatttaatgtgattcac |
14854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University