View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_low_16 (Length: 373)
Name: NF10118_low_16
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10118_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 13 - 148
Target Start/End: Complemental strand, 38052137 - 38052002
Alignment:
| Q |
13 |
tagggcaattctggagcaatataatagaagtttagttttagttttgtaatatgaattgattttttcatcgagaagactcttctccatctacaacggacaa |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38052137 |
tagggcaattctagagcaatataatagaagtttagttttagttttgtaatatgaattgatttcttcatcgagaagactcttctccatctacaacgaacaa |
38052038 |
T |
 |
| Q |
113 |
taagaagatacatacttacatacgtacatacatatt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052037 |
taagaagatacatacttacatacgtacatacatatt |
38052002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 155 - 359
Target Start/End: Complemental strand, 38051897 - 38051682
Alignment:
| Q |
155 |
caaggcataggataaacaacagatagagtgaaaggggcatgataagagaggttgttggtgccaacagtgctgttaagtagagtgtaaagagtttggatga |
254 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| || ||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38051897 |
caaggcatagaataaacaacagatagagtgaaaagg-catcataagagaggttg---gtgccaacagtgctgttaagtagagggtaaagagtttggatga |
38051802 |
T |
 |
| Q |
255 |
gaaggtagctgc-------------cacacattgaatcatattgatgcctatca-cat-atatagcagcgtctcatcttgttgttttcggtattgttaca |
339 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| || | |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38051801 |
gaaggtagctgcaacatagaagcagcacacattgaatcatattgatgcctatcagtatcacatagcagcgtctgatcttgttgttttcggtattgttaca |
38051702 |
T |
 |
| Q |
340 |
acacaatgtcagttctttct |
359 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
38051701 |
acacaaggtcagttctttct |
38051682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University