View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_low_23 (Length: 321)
Name: NF10118_low_23
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10118_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 202
Target Start/End: Original strand, 16330311 - 16330506
Alignment:
| Q |
7 |
gaagcaaaggtaatgaagtacagagatttagagactaataattgaatttgaaatactatatcattgatataatcttttaaaagcatatgctattgaaagg |
106 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16330311 |
gaagcaatggtaatgcagtacagagatttagagactaataattgaatttgaaatactatatcattgatataatcttttaaaagcatatgctattgaaagg |
16330410 |
T |
 |
| Q |
107 |
ttgagaactcattcaactatattatgatgcttgatacttaacatgacttgtgtaggatcctagtctaaacatgtgcctatggttaaaaataacaat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16330411 |
ttgagaactcattcaactatattatgatgcttgatacttaacatgacttgtgtaggatcctagtctaaacatgtgcctatggttaaatataacaat |
16330506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 227 - 307
Target Start/End: Original strand, 16330503 - 16330583
Alignment:
| Q |
227 |
caatattatttacttacctaaacaatattattttctaataaatttatcagattggagattttggtctggctaggactgaac |
307 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16330503 |
caatattatttactaccctaaacaatatttttttctaataaatttatcagattggagattttggtctggctaggactgaac |
16330583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University