View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_low_25 (Length: 308)
Name: NF10118_low_25
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10118_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 100 - 293
Target Start/End: Original strand, 32094572 - 32094765
Alignment:
| Q |
100 |
caaaatgtcttgtgcagtactcaaaatccatgtcaggatctttgtaccaaaagccaaaacttgggaaccgtggcattggaaacggaatgcgagcgatatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32094572 |
caaaatgtcttgtgcagtactcaaaatccatgtcaggatctttgtaccaaaagccaaaacttacgaaccgtggcattggaaacggaatgcgagcaatatt |
32094671 |
T |
|
| Q |
200 |
tttagaatcaagtcatggatcatgcggtactggcgtatttttacctcaaagagcagacacgaagttccaatcacgaaaaaagccaggttgatat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32094672 |
tttagaatcaagtcatggatcatgcggtacaggcgtatttttacctcaaagagcagacacgaagttccaaccacgaaaaaagccaggttgatat |
32094765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University