View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_low_31 (Length: 277)
Name: NF10118_low_31
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10118_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 45759825 - 45760042
Alignment:
| Q |
19 |
gatattggctattaatgctatatgttctcattgagcacatatagcacacttcttattttctatttcatcatgaaaaattgacaattgttgggtttctatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45759825 |
gatattggctattaatgctatatgttctcattgagcacatatagcacacttcttattttctatttgatcatgaaaaattgacaattgttgggtttctatt |
45759924 |
T |
 |
| Q |
119 |
agcccttcaccaatttttgtctttgtacgaaacattttattgggtcagcattacttggtgtatctcttccactagcatgatttccacttccaataattgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45759925 |
agcccttcaccaatttttgtctttgtacgaaacattttattgggtcagcattacttggtgtatctcttccactagcatgatttccacttccaataattgg |
45760024 |
T |
 |
| Q |
219 |
gacaataccaaataaaat |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45760025 |
gacaataccaaataaaat |
45760042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University