View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_low_33 (Length: 256)
Name: NF10118_low_33
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10118_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 45653218 - 45653000
Alignment:
| Q |
19 |
ggagtagttgtgcaaattttcttttatcaacaaaatggaaggaagcaaaagtgggtaacccatttcacccactagcagtagttgttctttatggttgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| || |
|
|
| T |
45653218 |
ggagtagttgtgcaaattttcttttatcaacaaaatggaaggaagcaaaagtgggtaacccatttcccccattagcagtagttgttctttatggttggaa |
45653119 |
T |
|
| Q |
119 |
ttgaattgatgggggcactctgcttaggtctatctcctctctctcaattagattgtgacaagcacacaaaacgttaaaatatcaataataaatggttatg |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45653118 |
ttgaattgatgggggtactctgcttaggtctatctcctctctctcaattagattgtgacaagcacacaaaacgttaaaatatcaataataaatggatatg |
45653019 |
T |
|
| Q |
219 |
gccacgtgtcaggaaaggg |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45653018 |
gccacgtgtcaggaaaggg |
45653000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University