View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_low_35 (Length: 253)
Name: NF10118_low_35
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10118_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 9601794 - 9601726
Alignment:
| Q |
145 |
tccccacaaactgttgttagatgagtattacttcttatttacattgtagtttctttaccgagttgcttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
9601794 |
tccccacaaactgttgttagatgagtattacttcttatttacgttgtagtttctttaccaagttgcttg |
9601726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 154 - 213
Target Start/End: Complemental strand, 9593031 - 9592972
Alignment:
| Q |
154 |
actgttgttagatgagtattacttcttatttacattgtagtttctttaccgagttgcttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||| |
|
|
| T |
9593031 |
actgttgttagatgagtattacttcttatttatattgtggtttctttacggagttgcttg |
9592972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 146
Target Start/End: Complemental strand, 9601878 - 9601824
Alignment:
| Q |
92 |
tcaaatttccatataagtatctgtttgctgtctcctctcattcgcatatatcatc |
146 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
9601878 |
tcaaatctccatacaagtatctgtttgctgcctcctctcattcacaaatatcatc |
9601824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 9581037 - 9580998
Alignment:
| Q |
20 |
ggttatgtctataaccttcttaaaataagcataagtgtct |
59 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
9581037 |
ggttatgtctaaaaccttcttataataagcataagtgtct |
9580998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 9586732 - 9586693
Alignment:
| Q |
20 |
ggttatgtctataaccttcttaaaataagcataagtgtct |
59 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
9586732 |
ggttatgtctaaaaccttcttataataagcataagtgtct |
9586693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University