View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_low_44 (Length: 241)
Name: NF10118_low_44
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10118_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 130 - 194
Target Start/End: Original strand, 54377076 - 54377140
Alignment:
| Q |
130 |
actacaataaataatgataatgactttttatctatattctcaactagatttcatcgaaataaata |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54377076 |
actacaataaataatgataatgactttttatctatattctcaactagatttcatcgaaataaata |
54377140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 54376947 - 54377004
Alignment:
| Q |
1 |
ttgtgcctcagcgatacggcatccgttttcagtttctcacgcgtgggaatacatggtg |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54376947 |
ttgtgcctcagcgatacggcatccgttttcagtttctcacgcgtgggaatacatggtg |
54377004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University