View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_low_47 (Length: 239)
Name: NF10118_low_47
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10118_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 37130752 - 37130957
Alignment:
Q |
18 |
cacattaggaaatgtgtttgtaattttaatacaatcaaaagattataacgacatcacgtgacatagtcttatctgctatgaatatatcttgtatatggct |
117 |
Q |
|
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | | | | | |
|
|
T |
37130752 |
cacattaggagatgtgtttgtaattttaatacattcaaaagattataacgacatcacatgacatagtcttatctgctatgaatatatcttctctgtagtt |
37130851 |
T |
 |
Q |
118 |
tttatattgaaaatgagaaaatctttcaatatttttgtcactacataatgtactctttatgcttatttccttatgtatccctctgttttcattctttagt |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37130852 |
tttatattgaaaatgagaaaatctttcaatatttttgtcactacataatgcactctttatgcttatttccttatgtatccctctgttttcattctttagt |
37130951 |
T |
 |
Q |
218 |
atacat |
223 |
Q |
|
|
|||||| |
|
|
T |
37130952 |
atacat |
37130957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 117 - 180
Target Start/End: Original strand, 37124375 - 37124438
Alignment:
Q |
117 |
ttttatattgaaaatgagaaaatctttcaatatttttgtcactacataatgtactctttatgct |
180 |
Q |
|
|
||||||||||||| ||| |||||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
T |
37124375 |
ttttatattgaaattgaaaaaatctttcaatattttggtcgctacatagtgtactctttatgct |
37124438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University