View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10118_low_58 (Length: 201)
Name: NF10118_low_58
Description: NF10118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10118_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 2 - 133
Target Start/End: Original strand, 22646638 - 22646769
Alignment:
| Q |
2 |
agggtcggagagatccaacaaaagtgttgaattaattcctaactattgcaaaataagagaccaaaaactatcagaaaaatcactactcataaaaatatga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
22646638 |
agggtcggagagatccaacaaaagtgttgaattaattcctgactattgcaaaataagagatcaaaaactaccagaaaaatcactactcataaaaagatga |
22646737 |
T |
 |
| Q |
102 |
tcaacatttttctccacaccacaacccctcac |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22646738 |
tcaacatttttctccacaccacaacccctcac |
22646769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University