View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10119_high_7 (Length: 353)
Name: NF10119_high_7
Description: NF10119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10119_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 7423124 - 7422863
Alignment:
Q |
1 |
tgcaaaatattaataagcatacgtc-gcttgatttaacacttcatgcgagcagacagatggttgtgattggctcttgttcgagggccataatccatgtac |
99 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
7423124 |
tgcaaaatattaataagcatacgtcagcttgatttaacacttcatgcgagcagacagatggttgtgattggcccttgttcgagggccataatccatgtac |
7423025 |
T |
 |
Q |
100 |
tgtgaatactttggggagtgtggtggatatgcatttgatttttggatccttgcaaacacccaaggcccactgttctacccttacgtaatgattgaatgat |
199 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
7423024 |
tgtgaatattttggggagtgtggtggatatgcatttgatttttggatccttgcaaacacccaaggcccactgttctaccctt-cgtaatgattgaatgat |
7422926 |
T |
 |
Q |
200 |
ggtgacggtggtgatggcgatggcgatggtgctagtgctgctaatattgccaatgtcgaagtc |
262 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7422925 |
ggtgacggtggtgatggcgatggtgatggtgctagtgctgctaatattgccaatgtcgaagtc |
7422863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University