View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10119_low_20 (Length: 279)
Name: NF10119_low_20
Description: NF10119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10119_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 20 - 209
Target Start/End: Original strand, 40853547 - 40853737
Alignment:
| Q |
20 |
tgttcgacac-gacacctgtcacacactggcgaatttgattacattcaatcatgctgttttctaaaattattgccggtgatgcgtcatcatagttaatta |
118 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40853547 |
tgttcgacactgacacctgtcacgcactggcgaatttgattacattcaatcatgctgttttctaaaattattgccggtgatgcgtcatcatagttaatta |
40853646 |
T |
 |
| Q |
119 |
ttaatattcatattctgtttttgttgctgagaattgagaaaggtatggtagaagagaagggcatagtgaaagatgttttgaacaacgaaag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
40853647 |
ttaatattcatattctgtttttgttgctgagaattgagaaaggtatggtagaagagaagggtatagtgaaagatgttttgaacaatgaaag |
40853737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University