View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10119_low_21 (Length: 271)
Name: NF10119_low_21
Description: NF10119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10119_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 243
Target Start/End: Complemental strand, 41834266 - 41834031
Alignment:
| Q |
15 |
agatttaccctctacattctatgtgtatcctttatgtgggaaaccataatctgtatttatctctctcaataaaataatctgttaatccttaatttagatt |
114 |
Q |
| |
|
||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41834266 |
agatttaccctctacattcaatatgtatcctttctgtgggaaaccataatctgtatttatctctctcaataaaataatctgttaatccttaatttagatt |
41834167 |
T |
|
| Q |
115 |
gtatgtgtgtatgaaaagtgaatatagttcaaaa-------aatagacactttaatgtaagttgcacatcaacacacaagtatccaaaacctattataag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41834166 |
gtatgtgtgtatgaaaagtgaatatagttcaaaacatttataatagacactttaatgtaagttgcacatcaacacacaagtatccaaaacctattctaag |
41834067 |
T |
|
| Q |
208 |
ggtatatactatactatatacactgccagctaaagc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41834066 |
ggtatatactatactatatacactgccagctaaagc |
41834031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University