View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10119_low_24 (Length: 252)
Name: NF10119_low_24
Description: NF10119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10119_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 26 - 103
Target Start/End: Original strand, 29373356 - 29373433
Alignment:
| Q |
26 |
attgataaacacagttgtctccacaaggatgatgattaattaaattcctcgtcaatcatgattttacttaggtgatag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29373356 |
attgataaacacagttgtctccacaaggatgatgattagttaaattcctcgtcaatcatgattttacttgggtgatag |
29373433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 187 - 236
Target Start/End: Original strand, 29373517 - 29373566
Alignment:
| Q |
187 |
ttagtattgttttaattatctctttgtcactctttggtaattgaggttct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29373517 |
ttagtattgttttaattatctctttgtcactctttggtaattgaggttct |
29373566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 103
Target Start/End: Complemental strand, 45086695 - 45086632
Alignment:
| Q |
40 |
ttgtctccacaaggatgatgattaattaaattcctcgtcaatcatgattttacttaggtgatag |
103 |
Q |
| |
|
||||||||||||| || ||||||||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
45086695 |
ttgtctccacaagaattgtgattaattaaataactcggcaatcatgatttaacttaggtgatag |
45086632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University