View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10119_low_26 (Length: 250)
Name: NF10119_low_26
Description: NF10119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10119_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 81 - 241
Target Start/End: Original strand, 19823783 - 19823938
Alignment:
| Q |
81 |
tttgtcgtcgtgttcaatttctctccttttctgaacttgtattaataatatacaagatcaaccaaaaatatctcttgtccttgctcttagaagataccat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||| || |
|
|
| T |
19823783 |
tttgtcgtcgtgttcaatttctctccttttctgaacttctattaataatatacaagatcaatcaaaaatatctcttgtccttgctctgagaag-----at |
19823877 |
T |
 |
| Q |
181 |
accagtgaacaagaggttaggttttggtcatgtgaccttttccaaaagttattcctttgct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19823878 |
accagtgaacaagaggttaggttttggtcatgtgaccttttccaaaagttattcctatgct |
19823938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 19822590 - 19822648
Alignment:
| Q |
1 |
tcttctttcttcaagcaatatgagctttttggtggagctgtgattatttaagtttaagg |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19822590 |
tcttctttcttcaagcaatatgagctttttggtggagctgtgattatttaagtttaagg |
19822648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 85
Target Start/End: Complemental strand, 23189935 - 23189902
Alignment:
| Q |
52 |
gtttaaggtttagggtttagggtttagggtttgt |
85 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
23189935 |
gtttagggtttagggtttagggtttagggtttgt |
23189902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 85
Target Start/End: Complemental strand, 23611190 - 23611157
Alignment:
| Q |
52 |
gtttaaggtttagggtttagggtttagggtttgt |
85 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
23611190 |
gtttagggtttagggtttagggtttagggtttgt |
23611157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 138 - 102
Alignment:
| Q |
47 |
tttaagtttaaggtttagggtttagggtttagggttt |
83 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
138 |
tttaggtttagggtttagggtttagggtttagggttt |
102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University