View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10119_low_6 (Length: 459)
Name: NF10119_low_6
Description: NF10119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10119_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 116 - 429
Target Start/End: Complemental strand, 53098656 - 53098374
Alignment:
| Q |
116 |
aacataaacaccgcatacattacatagtctcattctcattgctgtttttcagtcagaactcagaaccttaacttttcatttttattttcatttctcctct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53098656 |
aacataaacaccgcatacattacatagtctcattctcattgctgtttttcagtcagaactcagaaccttaacttttc------------atttctcctct |
53098569 |
T |
 |
| Q |
216 |
taatcataaatagataaatatcatcaatcgagaaagagaacnnnnnnnnntaaaatacaaaactgtggaattggaatggatgagacgaagaaggttatta |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53098568 |
taatcataaatagataaatatcatcaatcgagaaagagaacaaa-------aaaatacaaaactgtggaattggaatggatgagacgaagaaggttatta |
53098476 |
T |
 |
| Q |
316 |
ttatctaatggataaaactgtgatgaagaagaagaagaagcgtggtggtgacacaaaacaacaacaacaatctggtattttattctaaccctctttccct |
415 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53098475 |
ttatcaaatggataaaactgtgat---------gaagaagcgtggtggtgacacaa---aacaacaacaatctggtattttattctaaccctctttccct |
53098388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 64
Target Start/End: Complemental strand, 53098761 - 53098714
Alignment:
| Q |
17 |
ttattttcacaaaagaacctgattctctgaacgcaaggcacaacattg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53098761 |
ttattttcacaaaagaacctgattctctgaacgcaaggcacaacattg |
53098714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University