View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10119_low_8 (Length: 445)
Name: NF10119_low_8
Description: NF10119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10119_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 2e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 277 - 431
Target Start/End: Original strand, 3647420 - 3647575
Alignment:
Q |
277 |
cctttctgtttggtgtatattgatgcaaagttttgtatgctttctttttgaagcaaggaactca-ttctttcaagggcttgtcccaaatgcaagtatatg |
375 |
Q |
|
|
||||||||||||||||||||| |||||||||||| | | |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
T |
3647420 |
cctttctgtttggtgtatattcatgcaaagttttccaagatttctttttgaagcaaggaactcaattctttcaagtgcttgtcccaaatgcaagtatatg |
3647519 |
T |
 |
Q |
376 |
ccatataatagttccataatttcatgtttttcggtggtttcatgtgtatatcaact |
431 |
Q |
|
|
||||||||||| |||||||||||||||||| |||||||||||||||||||| |||| |
|
|
T |
3647520 |
ccatataatagctccataatttcatgttttccggtggtttcatgtgtatattaact |
3647575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University