View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10120_high_5 (Length: 255)
Name: NF10120_high_5
Description: NF10120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10120_high_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 4 - 255
Target Start/End: Original strand, 23017078 - 23017327
Alignment:
| Q |
4 |
gtggagaagcagagacaatcactgtctttccttcattgatattggacaaaaactcatccaaaccttggttattcagcaataccgtctccgctgatgtcac |
103 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23017078 |
gtggagaaacagacacaatcactgtctttccttcattgatattggacaaaaactcatccaaaccttggttattcagcaataccgtctccgctgatgtcac |
23017177 |
T |
|
| Q |
104 |
acatccactgcattacaaaacaaacttagaaactacggtttttacattatcaactacatcatagacnnnnnnnnnnnnnnnnnaaaactcagtatccgac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23017178 |
acatccactgcattacaaaacaaacttagaaactacggtttttacattatcaactacatcatagac--tatttttttttttttaaaactcagtatccgac |
23017275 |
T |
|
| Q |
204 |
tgaagacaaccgtccactagcaggggcctaattgatgctagaacaaagctct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23017276 |
tgaagacaaccgtccactagcaggggcctaattgatgctagaacaaagctct |
23017327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 4 - 128
Target Start/End: Complemental strand, 54914472 - 54914348
Alignment:
| Q |
4 |
gtggagaagcagagacaatcactgtctttccttcattgatattggacaaaaactcatccaaaccttggttattcagcaataccgtctccgctgatgtcac |
103 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||| ||| |||||||||| |||||||||||||||||| || | ||||| |||||||| |||||||| || |
|
|
| T |
54914472 |
gtggagaaacagacacaatcactgcctttcctttattaatattggacagaaactcatccaaaccttgcttctccagcataaccgtctctgctgatgtgac |
54914373 |
T |
|
| Q |
104 |
acatccactgcattacaaaacaaac |
128 |
Q |
| |
|
|||||||||| ||||| |||||||| |
|
|
| T |
54914372 |
acatccactgtattaccaaacaaac |
54914348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University