View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10120_low_15 (Length: 315)
Name: NF10120_low_15
Description: NF10120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10120_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 187 - 308
Target Start/End: Complemental strand, 9230878 - 9230757
Alignment:
| Q |
187 |
tagtctacacatagcattgggaacccttccttttgcaaaagatgaaaaaatccacgtggtcccacatggctatgctttccacgtcgtacactcgtgacat |
286 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9230878 |
tagtctatacatagcattgggaacccttccttttgcaaaagatgaaaaaatccacgtggtcccacatggctatgctttccacgtcgtacactcgtgacat |
9230779 |
T |
 |
| Q |
287 |
aggccctgttccagcccctttg |
308 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9230778 |
aggccctgttccagcccctttg |
9230757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 9231063 - 9230968
Alignment:
| Q |
1 |
gattggacaagtggccaaatagaaaggaaacaaatgaaatgaactaggccggtgcttaatgagggaccctttcatcaattaacatcattacagtcc |
96 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9231063 |
gattggacaagtggccatatagaaaggaaacaaatgaaatgaactaggccggtgcttaatgagggaccctttcatcaattaacatcattacagtcc |
9230968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University